Mesenchymal stem cells (MSCs) are adult stem cells characterized by their pluripotent nature, allowing them to differentiate into a wide range of cell types [21,22,23,24]. These MSCs can be derived from various tissues in the human body and can be expanded and self-renew in vitro. Regardless of their tissue source, MSCs share several common characteristics, including adhesion growth under standard tissue culture conditions. They express specific cell surface markers, such as CD73, CD90, and CD105, but lack the expression of markers such as CD34, CD45, and CD79 [24,25,26,27]. In vitro studies have demonstrated the ability of MSCs to differentiate into adipose, osteoblastic, and cartilage cells. Moreover, research has shown that MSCs can mediate the transfer of specific microRNAs (miRNAs), mRNAs, lipids, proteins, and even organelles through the extracellular vesicle (EV)-dependent pathway [28,29,30,31]. This transfer enables signal transmission and communication between different cells, ultimately influencing the biological function of recipient cells by modulating their microenvironment and internal signaling pathways. MSCs have been reported to have critical therapeutic effects on multiple inflammatory disorders through their anti-inflammatory properties via the EV pathway [32, 33]. In this study, we identified MenSC-EVs as a potential therapeutic approach for treating inflammatory atherosclerosis. Through small RNA screening analysis, we discovered that miR-574-5p, a previously identified regulator closely associated with the modulation of inflammatory signaling cascades -- particularly the NF-κB pathway -- exhibited high expression levels in MenSC-EVs. Based on these findings, we hypothesize that miR-574-5p carried by MenSC-derived EVs is likely to suppress inflammatory atherosclerosis by regulating the NF-κB pathway. Moreover, MenSCs offer several advantages over other sources of mesenchymal stem cells (MSCs), as they can be collected periodically, non-invasively, and without causing any trauma [34, 35]. In our earlier research, we discovered that 30-50 ml of menstrual blood can be collected during a menstrual cycle, and a 5 ml sample can produce 100 million passage 3 MSCs, which is adequate for clinical applications [34, 35]. Therefore, this groundbreaking research presents a promising therapeutic strategy for addressing inflammatory atherosclerosis.

Human umbilical vein endothelial cells (HUVECs) were cultured in complete ECM obtained from ScienCell (Carlsbad, CA, USA). Human monocyte THP-1 cells were cultured in RPMI medium (HyClone) supplemented with 10% (v/v) fetal calf serum (Gibco) and 100 units ml streptomycin and penicillin (Millipore, Billerica, MA, USA) and incubated at 37 °C in a humidified 5% CO incubator. Both the HUVEC and THP-1 cell lines were purchased from ScienCell Research Laboratories (ScienCell, Carlsbad, CA, USA). Human embryonic kidney 293 T cells (HEK293T) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37 °C with 5% CO. MEFs were isolated from embryos following previously reported methods [36].

Anti-CD9 (#BS9833M) and anti-CD81 (#BS91318) antibodies were purchased from Bioworld Technology, Inc. Anti-c-Rel (#82,000, for IF) antibody was from Cell Signaling Technology. Anti-CD63 (#25,682-1-AP), anti-calnexin (#10,427-2-AP), anti-eNOS (#27,120-1-AP), anti-c-Rel (#27,693-1-AP, for WB) and Anti-VCAM-1 (#11,444-1-AP) antibodies were purchased from Proteintech Group, Inc. For chemical reagents, Lipofectamine 3000 (#L3000015) was purchased from Invitrogen, GW4869 (#HY-19363) was purchased from MedChemExpress (Shanghai, China), TNFα (#H8916) was obtained from Sigma, and CellTracker™ Green CMFDA (#C2925) was purchased from Invitrogen. The NO-specific fluorescent dye, DAF-FM-DA (3-amino, 4-aminomethyl-2', 7'-difluorescein, diacetate) was obtained from Beyotime Biotechnology (#S0020S).

The siRNAs targeting human c-Rel (sic-Rel #1: siG000005966A-1-5; sic-Rel #2: siG000005966C-1-5) were purchased from Ribobio (Guangzhou, China). The siRNAs targeting mouse c-Rel (#siB170209024724-1-5) were also from Ribobio. In this study, we employed a combination of two distinct shRNAs for the AAV-mediated knockdown of c-Rel. The specific sequences used were: 5'-GAATGAGCCTGGACTATCA-3' and 5'-GATGCATTTGATAGATCAA-3'. For the AAV-mediated knockdown of c-Rel, these target sequences were inserted into an AAV-based core plasmid, creating two separate shRNAs. The core plasmids, along with the pAAV-RC8 and pHelper plasmids, were co-transfected into HEK293A cells to facilitate AAV production. Subsequently, the AAV was purified using an AAVpro Purification Kit (6666, Takara) in accordance with the manufacturer's instructions.

HUVECs were transfected with in vitro synthesized oligonucleotides designed to bind to the complementary sequence of miR-574-5p, thereby inhibiting its expression in HUVECs. The miR-574-5p inhibitor (#miR20004795-1-5) and the miR-574-5p mimic (#miR10004795-1-5) were both purchased from Ribobio (Guangzhou, China). To prepare miR-574-5p-overexpressing MenSC-EVs, a pLV-U6-based core vector expressing miR-574-5p was cotransfected with the psPAX2 packaging and pMD2.G envelope plasmids into HEK293T cells to produce lentiviral particles, following a previously described procedure [37]. The resulting lentiviruses were then used to infect MenSCs, and EVs were isolated at least 48 h post-infection.

The ApoE mice were from Cyagen (#C001067). The miR-574 mice were generated using the CRISPR/Cas9 gene-editing system. The gRNA sequences for the miR-574 mice are as follows: gRNA1: CGAGGGCCCTGCGTGGGTGCGGG; gRNA2: GAGGGTGCAGACCGGGCGTGCGG; gRNA3: TCACACGCCCGCACCCACGCAGG; gRNA4: CACCCACACGCCCGCACGCCCGG. To generate sufficient ApoE&miR-574 double homozygous mice, we crossed male ApoE&miR-574 mice with female ApoE&miR-574 mice, which were produced through in vitro fertilization using sperm and egg cells from heterozygous ApoE&miR-574 mice. This cross generates ApoE&miR-574 male mice, which were used for atherosclerosis model studies. Genotyping was verified using PCR analysis (Fig. S5), with the following primer sequences: For ApoE mice: Forward, 5'-GCCTAGCCGAGGGAGAGCCG-3'; Reverse, 5'-GCCGCCCCGACTGCATCT-3'. For miR-574 mice: Forward, 5'-CCCCAGTGCTTCGTAATGGAAG-3'; Reverse, 5'-TGATGGATCAGGATGGAGGTCAAG-3'. For the induction of the atherosclerosis model, 8-week-old male mice were fed a high-fat diet (HFD) containing 1.25% cholesterol and 21% crude fat for 16 weeks. Throughout the high-fat feeding period, EVs released by 1 × 10 MenSCs were dissolved in 60 µl of PBS and administered to the mice via tail-vein injection once every 2 weeks. For AAV-mediated c-Rel depletion, we administered a combination of AAVs encoding two shRNAs that specifically target c-Rel to 8-week-old male mice via tail vein injection at a concentration of 1 × 10 viral genome/ml (vg/ml). All the mice were housed under specific pathogen-free (SPF) conditions with a 12-h light/12-h dark cycle at 21-24 °C and 40-60% humidity. At the conclusion of the animal studies, all the mice were euthanized using carbon dioxide inhalation. All animal experiments were conducted in accordance with the guidelines and regulations established by the Ethics Committee of Bengbu Medical University. Mice from different groups were randomly assigned to eliminate bias related to the order of MenSC-EV or virus injections. Experimental data were collected and analyzed in a blinded manner, ensuring that both the operator and designer remained unaware of each other's identities.

The entire aorta was isolated and subsequently subjected to Oil Red O staining for en-face analysis. Photographs of the isolated aorta were taken via a digital camera. In addition, the aortic roots were frozen in optimal cutting temperature (OCT) compound and sectioned at a 7 µm thickness for subsequent Oil Red O staining to measure the lipid content.

Reverse transcription of 1 µg of total RNA extracted from specific cells was performed via a commercial kit (#G486, Applied Biological Materials). For miRNA reverse transcription, a stem loop-based method was employed to synthesize first-strand cDNA, and U6 snRNA was used as a normalizer and quantifier. The quantitative PCR assay was conducted using EvaGreen qPCR Master Mix following the provided instructions. Relative gene expression was determined via the 2 method. For the quantification of proinflammatory factors, GAPDH was utilized as a normalization control. The sequences of primers used for qRT-PCR in this study are shown in Additional file 1: Tables 1 and 2.

MenSCs were obtained from Healthy young women aged 25 to 35, provided by the Zhongyuan Stem Cell Research Institute in the Xinxiang High Tech Zone. Informed consent was obtained from all participants involved in the study. The isolation of MenSCs from menstrual blood followed established protocols [35, 38]. In brief, menstrual blood was collected using menstrual cups and subsequently diluted with an equal volume of phosphate-buffered saline (PBS) containing 1% puromycin and a small amount of Heparin sodium to prevent clotting. The diluted samples were then separated using a standard Ficoll procedure. The deciduous endometrium and karyocytes were re-suspended in DMEM complete medium and cultured in an incubator at 37 °C with 5% CO. After 24 h of incubation, unattached cells were discarded, and fresh medium was added to the culture. For the experiments, MenSCs from passages three to five were utilized. The phenotype of MenSCs was evaluated using fluorescence-activated cell sorting (FACS) with a stem cell surface marker detection kit (562,245, BD Biosciences, USA) via flow cytometry analysis. The results indicated that MenSCs were positive for CD90, CD73, and CD105, while negative for CD45, CD34, CD11b, CD19, and HLA-DR (Additional file 1: Fig. S1).

For the isolation of MenSC-derived extracellular vesicles (MenSC-EVs), the MenSCs were cultured until they reached 80% confluency, at which point the culture medium was collected. This medium was then processed through differential ultracentrifugation using an XPN-100 (Beckman Coulter, USA), following previously established protocols [32]. The isolated MenSC-EVs were characterized using transmission electron microscopy and nanoparticle flow cytometry. Positive surface markers of the EVs, including CD63, CD9, and CD81, along with the negative marker Calnexin, were identified through Western blot analysis. The isolated EVs were subsequently dissolved in phosphate-buffered saline (PBS) for further application in an animal study. Each mouse received a tail-vein injection of the EVs, with 60 µl of PBS used to dissolve the EVs derived from 1 × 10 MenSCs.

HUVEC monolayers infected with the miR-574-5p mimic were cultured in a 6-well plate. The cells were subsequently treated with TNFα (20 ng/ml, 2 h) before being incubated with THP-1 monocytes. The THP-1 cells were prelabeled with CellTracker Green CMFDA (8 µM, 0.5 h) at 37 °C. Each well of HUVECs was then incubated with 0.2 ml of CMFDA-labeled THP-1 cells dissolved in a complete medium (10 cells ml). After 2 h of incubation at 37 °C, the cells were subjected to three washes with a complete medium. Finally, the adherent monocytes were imaged via fluorescence microscopy.

HUVECs cultured in a 6-well plate were transfected with either a miR-574-5p mimic or c-Rel shRNAs when they reached 80% confluence. Forty-eight hours post-transfection, the cells were incubated with a NO-specific fluorescent dye, DAF-FM-DA (3-amino, 4-aminomethyl-2', 7'-difluorescein, diacetate), at 37 °C for 40 min, then washed with PBS. After three washes, the cells were imaged using a fluorescence microscope.

The mRNA sequencing experiments were conducted by Annoroad (Beijing, China). In brief, total RNA was extracted via TRIzol reagent and subjected to Library construction following standard Illumina protocols. The Libraries were sequenced via the paired-end RNA-seq approach on the Illumina NovaSeq 6000 sequencing platform. For data analysis, the raw reads were aligned to the reference genome via HTSeq-count and subsequently processed via Cufflinks. Cufflinks utilizes normalized RNA-seq fragment counts to assess the relative abundances of transcripts. DESeq2 is designed for differential gene expression analysis, based on the negative binomial distribution for count values. Unlike DESeq, DESeq2 estimates sample depth and gene-specific parameters, using linear regression for dispersion to account for shared expression deviations among similarly expressed genes. It estimates the expression level of each gene in each sample using linear regression, calculates p-values with the Wald test, and corrects them using the BH method. Genes with q ≤ 0.05 and |log2_ratio|≥ 1 are identified as differentially expressed genes (DEGs). The raw data have been deposited in the Sequence Read Archive (SRA) database with the accession numbers SRR25209372, SRR25209373, SRR25209374, SRR25209375, SRR25209376, and SRR25209377.

The miRNA microarray chip screening experiments were conducted by OE Biotechnology (Shanghai, China). Briefly, total RNA was extracted from MenSC-EVs derived from two different donors and quantified. Sample labeling, microarray hybridization, and washing were performed according to the manufacturer's standard protocol. The raw data have been deposited in the NCBI GEO database under accession number GSE223537.

To investigate whether c-Rel is a direct target gene of miR-574-5p, a construct containing the c-Rel 3'-UTR with either the normal miR-574-5p-binding site or a mutant binding site was inserted into the psiCHECK-2 reporter vector. These constructed reporter vectors were cotransfected with either the miR-574-5p mimic or a mock negative control into HEK293T cells. The cells were then incubated for 48 h. After incubation, the cells were harvested and lysed. The luciferase activity was measured via a Dual-Luciferase Reporter Gene Assay Kit (#RG028, Beyotime, China) according to the manufacturer's instructions.

First, MenSCs were transfected with miR-574-5p mimics. After 24 h of transfection, MenSCs overexpressing the miR-574-5p mimic were pretreated with GW4869 (10 µM) for 24 h, while the control group received PBS as a pretreatment. Following GW4869 treatment, MenSCs were subsequently seeded in the upper chamber of a 0.4 µm transwell plate and then cocultured with HUVECs seeded in the lower chamber.

One microgram of MenSC-EVs was incubated with 1 × 10 HUVECs for 10 h. Prior to harvesting, the HUVECs were exposed to TNFα (20 ng/ml, 2 h) or a vehicle control (PBS). The cells were subsequently subjected to qPCR and Western blotting analyses.

Briefly, in this study, the cells were first rinsed with PBS and then fixed with 4% formaldehyde for 15 min at room temperature. The fixed cells were then permeabilized with buffer containing 0.5% Triton X-100 and 5 mM vanadyl ribonucleoside complex (#R3380, Sigma) on ice for 10 min. After being washed with 2 × SSC, the cells were subjected to hybridization using an antisense probe against miR-574-5p, which had the sequence 5'-ACACACTCACACAC ACACACTCA-3' and was conjugated with Cy3. The detailed procedures for hybridization were conducted as previously described [39].

Two patients with coronary artery atherosclerosis were recruited to analyze the correlation between the miR-574-5p/c-Rel axis and atherogenesis. A normal great saphenous vein served as a negative control. Informed written consent was obtained from all participants involved in the study. Detailed information regarding the patients is provided in Additional file 1: Table 3.

In this study, statistical analyses were performed via GraphPad Prism software. For comparisons between two groups, a two-tailed Student's t-test was used. For comparisons involving three or more groups, one-way ANOVA followed by Tukey's post hoc test was utilized. A P-value less than 0.05 was considered statistically significant. All data presented in the study are based on at least three independent experiments and are expressed as the mean ± standard deviation (SD).